Basic Guessing Game Mechanics in C# - c#

I've had quite a bit of experience with programming (three semesters teaching VBasic, C++, and Java), and now I'm in college and I'm taking a C# class, which is quite boring (the teacher knows less than I do).
Anyways, for one of our exercises, we're creating a number guessing/lottery game. It works kind of like this:
User inputs three integers from 1-4 and clicks submit (I have them storing into an array)
Program generates three numbers from 1-4 (also in an array)
Function that checks matching runs and checks the two arrays
If all three match in order (i.e. 1,2,3 = 1,2,3 and NOT 1,2,3 = 1,3,2), matching = 4
If all three match NOT in order, matching = 3
If only two match, matching = 2
I want to make sure that only one match counts as one (i.e. [1,1,2][1,2,3] only gives one match to the user.
If only one matches, matching = 1
If no matches, matching stays at 0 (it's instantiated at submit_click)
I've got all of the code and GUI working except for the matching logic. I know I could do it with a LARGE amount of if statements, and I know cases would probably work, but I'm not as experienced with cases.
I'm not expecting my 'homework' to be done here, but I just want to know what method would be most effective to get this to correctly work (if it's easier to exclude the one match per item, then that's fine), and to possibly see some working code.
Thanks!
EDIT
I apologize if I come across as arrogant, I didn't mean to come across as a know-it-all (I definitely do not).
I have NOT taught classes, I've just taken classes from a teacher who's primarily a programming in and I'm at a community college and my professor isn't primarily a programming teacher.
I didn't take time to write a ton of if statements because I know that it would just get shot down as ineffective. I currently don't have the resources to test the answers, but as soon as I can I'll check them out and post back.
Again, I apologize for coming across as rude and arrogant, and I appreciate your answers more than you know.
Thanks again!

You can use a loop to achieve this functionality. I've used a list simply for ease of use, performing remove operations and the like. Something like this should work:
public static int getNumberOfMatches(List<int> userGuesses, List<int> machineGuesses) {
// Determine list equality.
bool matchedAll = true;
for (int i = 0; i < userGuesses.Count; i++) {
if (userGuesses[i] != machineGuesses[i]) {
matchedAll = false;
break;
}
}
// The lists were equal; return numberOfGuesses + 1 [which equals 4 in this case].
if (matchedAll) {
return userGuesses.Count + 1;
}
// Remove all matches from machineGuesses.
foreach (int userGuess in userGuesses) {
if (machineGuesses.Contains(userGuess)) {
machineGuesses.Remove(userGuess);
}
}
// Determine number of matches made.
return userGuesses.Count - machineGuesses.Count;
}

I think for the first case, for all matches in order you would scan the arrays together and maybe increment a counter. Since you mentioned you know c++, this would be
int userGuesses[3];
int randomGen[3];
int matches = 0;
for(int i=0; i < 3; i++) if(userGuesses[i] == randoGen[i]) matches++;
if(matches == 3) //set highest score here.
if(matches == 2) // next score for ordered matches etc.
For the not-in-order case, you will need to lookup the generated array for each user guess to see if it has that value.

Related

C# Fastest way to determine if a string contains all elements of a list

Quick background. I have a string of words - I separate out those words into a List (I've tried HashSet it doesn't make any difference - and you lose the ordered nature of a List).
I then manipulate the original words in many dull ways - and create thousands of "new strings" - all of these strings are in a StringBuilder which has been set .ToString();
At the end of the manipulation, I want to QC those new strings - and be sure that every word that was in the original set - is still somewhere in those new strings and I have not accidentally lost a word.
That original string, can run to hundreds of individual words.
Short Example:
List<string> uniqueWords = new List<string> { "two", "three", "weather sunday" };
string final = "two and tomorrow\n\rtwo or wednesday\n\rtwo with thursday\n\rtwo without friday\n\rthree gone tomorrow\n\rthree weather saturday\n\rthree timely sunday";
The output string can run to tens of millions of characters, millions of words, 200,000+ rows of data (when split). You may notice that there are words that are actually two words separated by a space - so I cannot simply split out the individual words by splitting on the space as comparing them to the original would fail, and I need to confirm the words are exactly as they appeared originally - having weather somewhere and sunday somewhere - is not the same as having 'weather sunday' - for my purposes.
The the code I have tried so far and have benchmarked:
First attempt:
var allWords = uniqueWords.Where(substring => final.Contains(substring, StringComparison.CurrentCultureIgnoreCase)).ToList();
Second Attempt:
List<string> removeableList = new(uniqueWords);
foreach (var item in uniqueWords)
{
if (removeableList.Count == 0)
{
break;
}
if (final.Contains(item))
{
removeableList.Remove(item);
}
}
Third Attempt:
List<string> removeableList = new(uniqueWords);
for (int i = uniqueWords.Count; i >= 0; i--)
{
if (removeableList.Count == 0)
{
break;
}
if (final.Contains(uniqueWords[i]))
{
removeableList.Remove(uniqueWords[i]);
}
}
These are the results:
These results are repeatable, though I will say that the First Attempt tends to fluctuate quite a lot while the Second and Third Attempts tend to remain at about the same level - the Third Attempt does seem to do better than the Second rather consistently.
Are there any options that I am missing?
I have tried it using a Regex Matches collection into a HashSet - oh that was bad, 4 times worse than the First Attempt.
If there is a way to improve the performance on this task I would love to find it.
Your attempt #1 uses CurrentCultureIgnoreCase which will be slow. But even after removing that, you are adding to the list, rather than removing, and therefore the list might need to be resized.
You are also measuring two different things: option #1 is getting the list of words which are in final, the others get the list of words which are not.
Further options include:
Use List.RemoveAll
List<string> remainingWords = new(uniqueWords);
remainingWords.RemoveAll(final.Contains); // use delegate directly, without anonymous delegate
Use a pre-sized list and use Linq
List<string> remainingWords = new(uniqueWords.Length);
remainingWords.AddRange(uniqueWords.Where(s => !final.Contains(s)));
Each of these two options can be flipped depending on what result you are trying to achieve, as mentioned.
List<string> words = new(uniqueWords);
words.RemoveAll(s => !final.Contains(s));
List<string> words = new(uniqueWords.Length);
words.AddRange(uniqueWords.Where(final.Contains)); // use delegate directly, without anonymous delegate
#Charlieface, thanks for that - I tried those, I think you have a point about adding to a list - as that appears much slower. For me it doesn't matter whether it is adding or removing, the result is a True/False return - whether the list is empty or of the size of the original list.
Sixth Attempt:
List<string> removeableList = new(uniqueWords.Count);
removeableList.AddRange(uniqueWords.Where(s => !parsedTermsComplete!.Contains(s)));
Seventh Attempt:
List<string> removeableList = new(uniqueWords);
removeableList.RemoveAll(parsedTermsComplete!.Contains);
Results in comparison to Third Attempt (fastest generally):
The adding does appear slower - and memory is a little higher for the RemoveAll but timing is consistent - bearing in mind it fluctuates depending on what Windows decides to do at any given moment...
Here is an interesting implementation of the AhoCorasickTree method - which I saw mentioned on this site somewhere else.
My knowledge on this is extremely limited so this may not be a good implementation at all - I am not saying it is a good implementation just that it works - this comes from a nuget package, but I am unsure on SO's policy on nuget package links, so won't link for now. In testing, creating an array was faster than creating a list.
Eighth Attempt:
var wordArray = uniqueWords.ToArray();
int i = uniqueWords.Count - 1;
foreach (var item in wordArray)
{
var keyWords = new AhoCorasickTree(new[] { item });
if (keyWords.Contains(parsedTermsComplete))
{
uniqueWords.RemoveAt(i);
}
i--;
}
I noticed in testing that creating a "removableList" was actually slower than creating a removableArray (found this out implementing the above Aho run). I updated the Third Attempt to incorporate this:
var removeableArray = uniqueWords.ToArray();
for (int i = removeableArray.Length -1; i >= 0; i--)
{
if (!uniqueWords.Any())
{
break;
}
if (parsedTermsComplete!.Contains(removeableArray[i]))
{
uniqueWords.RemoveAt(i);
}
}
The Benchmarks come out like this, the Third Attempt is updated to an array, the Seventh Attempt is the AhoCorasick implementation on a list, and the Eighth Attempt is the AhoCorasick implementation on an Array.
The ToArray - does seem faster than List, which is good to know.
My only issue with the AhoCorasick is that in practice - in a WASM application - this is actually much slower, so not a good option for me - but I put it here because it does seem to be much faster in Benchmarks (may be using multiple threads where WASM is limited to 1) and doesn't appear to allocate any memory, so might be useful to someone - interesting that the Third Attempt also appears to be allocated no memory when using an Array implementation whereas on a list it was allocated.

Arrays in a demo application

the thing I'm having the most trouble with is understanding the assignment here. I don't know if it's the fact if it's worded weird or that I'm just stupid. I'm not asking for you to do my assignment for me I just want to know if someone would explain what it's asking for.
UPDATE: apparently I now have to use enum on this so now I'm screwed
Please post the content of the question in your post, i.e. copy and past the text.
Secondly, break it down into sections.
1) You must write a program called IntArrayDemo.
2) The program must contain an array that stores 10 Integers (int).
int[] valueArray = new int[10] {1,2,3,4,5,6,7,8,9,10 };
3) The program will run until a sentinal value is entered (i.e. you type something that causes the program to quite, say 'q' or '-1').
while (Console.ReadKey().Key != ConsoleKey.Q) {
ConsoleKey k = Console.ReadKey().Key;
//Check the key here
}
4) The program will have 3 options -
4.1) View the entire array of integers from 0 to 9 (i.e. forwards)
4.2) View the entire array of integers from 9 to 0 (i.e. backwards)
4.3) View a specific location (i.e. you enter a number from 0 to 9, and you are shown the value at that point in the array.
You will need to display some sort of menu on the screen listing the options.
For each of the parts where you need to show the content of the array, use a for loop. While loops, or ForEach loops should never be used of you have a fixed number of things to iterate over.
"I don't know if it's the fact if it's worded weird or that I'm just stupid"
In this case, I'm not sure either of those options is accurate. Programming questions are worded quite carefully to force you to think about breaking the task into sections.
In professional programming, you will get all sorts of weirdly worded questions about how something can be done, and you must break down the problem into steps and solve each one.
It's easy to feel a little overwhelmed when you get a single paragraph with a lot of information in it, but breaking it down makes it much more manageable.
Always start with what you know for certain has to be done - in this case, the program must be called IntArrayDemo, so that's a good starting point.
'that stores an array of 10 integers' - good, more information! The program must have an array, which stores ints, and can hold 10 values.
We can infer from this (knowing that arrays start from 0) that our array must count from 0 to 9.
Enums
You mention that you need to use enums. Enums are just a data type, which you can define yourself.
Supposing you were writing a server program, and needed to easily see what state it was in.
The server can be in the following states at any time - Starting, Running, Stopping, Stopped.
You could use a string easily enough - String state = "Starting" would do the trick, but a string can hold any value.
As the server HAS to be in one of those states, an enum is better, as you can specify what those states are.
To declare an enum, you create it as follows...
enum SERVER_STATE { Starting, Running, Stopping, Stopped };
Then to use it....
SERVER_STATE CurrentServerState = SERVER_STATE.Stopped;
if (CurrentServerState == SERVER_STATE.Running) {
//Do something here only if the enum is set to 'Running'
}
If you wanted to use an enum to decide which option was chosen, you would need to do the following.
1) Get some text of the keyboard (the example using ReadChar above shows you how to do that)
2) Set an enum value based on what was entered
enum ACTION = { ListValuesForward, ListValueBackward, ListSpecificValue };
ACTION WhichOption;
//Our ConsoleKey object is called 'k', so....
if (k == ConsoleKey.F) {
WhichOption = ACTION.ListValuesForward;
}
if (WhichOption == Action.ListValuesForward) {
//Print out the array forwards
}
Knowing that we have an array, that counts from 0 to 9, we can work out that the best loop here is a for loop, as it's controlled by a counter variable.
If you always break a problem down like this, it becomes a lot less daunting.
Hopefully, this should explain the question clearly enough to get you started.

How to compare an array loaded from file with another array loaded from another file c#

I have to do a program in C# Form, which has to load from a file which looks something like that:
100ACTGGCTTACACTAATCAAG
101TTAAGGCACAGAAGTTTCCA
102ATGGTATAAACCAGAAGTCT
...
120GCATCAGTACGTACCCGTAC
20 lines formed with a number (ID) and 20 letters (ADN); the other file looks like that:
TGCAACGTGTACTATGGACC
In few words, this is a game where a murder is done, there are 20 people; i have to load and split the letters and.. i have to compare them and in the end i have to find the best match.
I have no idea how to do that, I don't know how to load the letters in the array and then to split them.. and then to compare them.
What you want to do here, is use something like a calculation of the Levenshtein distance between the strings.
In simple terms, that provides a count of how many single letters you have to change for a string to become equal to another. In the context of DNA or Proteins, this can be interpreted as representing the number of mutations between two individuals or samples. A shorter distance will therefore indicate a closer relationship between the two.
The algorithm can be fairly heavy computationally, but will give you a good answer. It's also quite fun and enlightening to implement. You can find a couple of ways of implementing it under the wikipedia article.
If you find it challenging to understand how it works, I recommend you set up an example grid by hand, with one short string horizontally along the top, and one vertically along the left side, and try going through the calculations manually, just to understand the concept properly (it can be confusing at first, but is really not that difficult).
This is a simple match function. It might not be of the complexity your game requires. This solution does not require an explicit split on the strings in order to get an array of DNA "letters". The DNA is compared in place.
Compare each "suspect" entry to the "evidence one.
int idLength = 3;
string evidence = //read from file
List<string> suspects = //read from file
List<double> matchScores = new List<double>();
foreach (string suspect in suspects)
{
int count = 0;
for (int i = idLength; i < suspect.Length; i++)
{
if (suspect[i + idLength] == evidence[i]) count++;
}
matchScores.Add(count * 100 / evidence.Length);
}
The matchScores list now contains all the individual match scores. I did not save the maximum match score in a separate variable as there can be several "suspects" with the same score. To find out which subject has the best match, just iterate the matchScores list. The index of the best match is the index of the suspect in the suspects list.
Optimization notes:
you could check each "suspect" string to see where (i.e. at what index does) the DNA sequence starts, as it could be variable;
a dictionary could be used here, instead of two lists, with the "suspect string" as key and the match score as value

Remove duplicates from array of struct

I can't figured out in remove duplicates entries from an Array of struct
I have this struct:
public struct stAppInfo
{
public string sTitle;
public string sRelativePath;
public string sCmdLine;
public bool bFindInstalled;
public string sFindTitle;
public string sFindVersion;
public bool bChecked;
}
I have changed the stAppInfo struct to class here thanks to Jon Skeet
The code is like this: (short version)
stAppInfo[] appInfo = new stAppInfo[listView1.Items.Count];
int i = 0;
foreach (ListViewItem item in listView1.Items)
{
appInfo[i].sTitle = item.Text;
appInfo[i].sRelativePath = item.SubItems[1].Text;
appInfo[i].sCmdLine = item.SubItems[2].Text;
appInfo[i].bFindInstalled = (item.SubItems[3].Text.Equals("Sí")) ? true : false;
appInfo[i].sFindTitle = item.SubItems[4].Text;
appInfo[i].sFindVersion = item.SubItems[5].Text;
appInfo[i].bChecked = (item.SubItems[6].Text.Equals("Sí")) ? true : false;
i++;
}
I need that appInfo array be unique in sTitle and sRelativePath members the others members can be duplicates
EDIT:
Thanks to all for the answers but this application is "portable" I mean I just need the .exe file and I don't want to add another files like references *.dll so please no external references this app is intended to use in a pendrive
All data comes form a *.ini file what I do is: (pseudocode)
ReadFile()
FillDataFromFileInAppInfoArray()
DeleteDuplicates()
FillListViewControl()
When I want to save that data into a file I have these options:
Using ListView data
Using appInfo array (this is more faster¿?)
Any other¿?
EDIT2:
Big thanks to: Jon Skeet, Michael Hays thanks for your time guys!!
Firstly, please don't use mutable structs. They're a bad idea in all kinds of ways.
Secondly, please don't use public fields. Fields should be an implementation detail - use properties.
Thirdly, it's not at all clear to me that this should be a struct. It looks rather large, and not particularly "a single value".
Fourthly, please follow the .NET naming conventions so your code fits in with all the rest of the code written in .NET.
Fifthly, you can't remove items from an array, as arrays are created with a fixed size... but you can create a new array with only unique elements.
LINQ to Objects will let you do that already using GroupBy as shown by Albin, but a slightly neater (in my view) approach is to use DistinctBy from MoreLINQ:
var unique = appInfo.DistinctBy(x => new { x.sTitle, x.sRelativePath })
.ToArray();
This is generally more efficient than GroupBy, and also more elegant in my view.
Personally I generally prefer using List<T> over arrays, but the above will create an array for you.
Note that with this code there can still be two items with the same title, and there can still be two items with the same relative path - there just can't be two items with the same relative path and title. If there are duplicate items, DistinctBy will always yield the first such item from the input sequence.
EDIT: Just to satisfy Michael, you don't actually need to create an array to start with, or create an array afterwards if you don't need it:
var query = listView1.Items
.Cast<ListViewItem>()
.Select(item => new stAppInfo
{
sTitle = item.Text,
sRelativePath = item.SubItems[1].Text,
bFindInstalled = item.SubItems[3].Text == "Sí",
sFindTitle = item.SubItems[4].Text,
sFindVersion = item.SubItems[5].Text,
bChecked = item.SubItems[6].Text == "Sí"
})
.DistinctBy(x => new { x.sTitle, x.sRelativePath });
That will give you an IEnumerable<appInfo> which is lazily streamed. Note that if you iterate over it more than once, however, it will iterate over listView1.Items the same number of times, performing the same uniqueness comparisons each time.
I prefer this approach over Michael's as it makes the "distinct by" columns very clear in semantic meaning, and removes the repetition of the code used to extract those columns from a ListViewItem. Yes, it involves building more objects, but I prefer clarity over efficiency until benchmarking has proved that the more efficient code is actually required.
What you need is a Set. It ensures that the items entered into it are unique (based on some qualifier which you will set up). Here is how it is done:
First, change your struct to a class. There is really no getting around that.
Second, provide an implementation of IEqualityComparer<stAppInfo>. It may be a hassle, but it is the thing that makes your set work (which we'll see in a moment):
public class AppInfoComparer : IEqualityComparer<stAppInfo>
{
public bool Equals(stAppInfo x, stAppInfo y) {
if (ReferenceEquals(x, y)) return true;
if (x == null || y == null) return false;
return Equals(x.sTitle, y.sTitle) && Equals(x.sRelativePath,
y.sRelativePath);
}
// this part is a pain, but this one is already written
// specifically for your question.
public int GetHashCode(stAppInfo obj) {
unchecked {
return ((obj.sTitle != null
? obj.sTitle.GetHashCode() : 0) * 397)
^ (obj.sRelativePath != null
? obj.sRelativePath.GetHashCode() : 0);
}
}
}
Then, when it is time to make your set, do this:
var appInfoSet = new HashSet<stAppInfo>(new AppInfoComparer());
foreach (ListViewItem item in listView1.Items)
{
var newItem = new stAppInfo {
sTitle = item.Text,
sRelativePath = item.SubItems[1].Text,
sCmdLine = item.SubItems[2].Text,
bFindInstalled = (item.SubItems[3].Text.Equals("Sí")) ? true : false,
sFindTitle = item.SubItems[4].Text,
sFindVersion = item.SubItems[5].Text,
bChecked = (item.SubItems[6].Text.Equals("Sí")) ? true : false};
appInfoSet.Add(newItem);
}
appInfoSet now contains a collection of stAppInfo objects with unique Title/Path combinations, as per your requirement. If you must have an array, do this:
stAppInfo[] appInfo = appInfoSet.ToArray();
Note: I chose this implementation because it looks like the way you are already doing things. It has an easy to read for-loop (though I do not need the counter variable). It does not involve LINQ (wich can be troublesome if you aren't familiar with it). It requires no external libraries outside of what .NET framework provides to you. And finally, it provides an array just like you've asked. As for reading the file in from an INI file, hopefully you see that the only thing that will change is your foreach loop.
Update
Hash codes can be a pain. You might have been wondering why you need to compute them at all. After all, couldn't you just compare the values of the title and relative path after each insert? Well sure, of course you could, and that's exactly how another set, called SortedSet works. SortedSet makes you implement IComparer in the same way that I implemented IEqualityComparer above.
So, in this case, AppInfoComparer would look like this:
private class AppInfoComparer : IComparer<stAppInfo>
{
// return -1 if x < y, 1 if x > y, or 0 if they are equal
public int Compare(stAppInfo x, stAppInfo y)
{
var comparison = x.sTitle.CompareTo(y.sTitle);
if (comparison != 0) return comparison;
return x.sRelativePath.CompareTo(y.sRelativePath);
}
}
And then the only other change you need to make is to use SortedSet instead of HashSet:
var appInfoSet = new SortedSet<stAppInfo>(new AppInfoComparer());
It's so much easier in fact, that you are probably wondering what gives? The reason that most people choose HashSet over SortedSet is performance. But you should balance that with how much you actually care, since you'll be maintaining that code. I personally use a tool called Resharper, which is available for Visual Studio, and it computes these hash functions for me, because I think computing them is a pain, too.
(I'll talk about the complexity of the two approaches, but if you already know it, or are not interested, feel free to skip it.)
SortedSet has a complexity of O(log n), that is to say, each time you enter a new item, will effectively go the halfway point of your set and compare. If it doesn't find your entry, it will go to the halfway point between its last guess and the group to the left or right of that guess, quickly whittling down the places for your element to hide. For a million entries, this takes about 20 attempts. Not bad at all. But, if you've chosen a good hashing function, then HashSet can do the same job, on average, in one comparison, which is O(1). And before you think 20 is not really that big a deal compared to 1 (after all computers are pretty quick), remember that you had to insert those million items, so while HashSet took about a million attempts to build that set up, SortedSet took several million attempts. But there is a price -- HashSet breaks down (very badly) if you choose a poor hashing function. If the numbers for lots of items are unique, then they will collide in the HashSet, which will then have to try again and again. If lots of items collide with the exact same number, then they will retrace each others steps, and you will be waiting a long time. The millionth entry will take a million times a million attempts -- HashSet has devolved into O(n^2). What's important with those big-O notations (which is what O(1), O(log n), and O(n^2) are, in fact) is how quickly the number in parentheses grows as you increase n. Slow growth or no growth is best. Quick growth is sometimes unavoidable. For a dozen or even a hundred items, the difference may be negligible -- but if you can get in the habit of programming efficient functions as easily as alternatives, then it's worth conditioning yourself to do so as problems are cheapest to correct closest to the point where you created that problem.
Use LINQ2Objects, group by the things that should be unique and then select the first item in each group.
var noDupes = appInfo.GroupBy(
x => new { x.sTitle, x.sRelativePath })
.Select(g => g.First()).ToArray();
!!! Array of structs (value type) + sorting or any kind of search ==> a lot of unboxing operations.
I would suggest to stick with recommendations of Jon and Henk, so make it as a class and use generic List<T>.
Use LINQ GroupBy or DistinctBy, as for me it is much simple to use built in GroupBy, but it also interesting to take a look at an other popular library, perhaps it gives you some insights.
BTW, Also take a look at the LambdaComparer it will make you life easier each time you need such kind of in place sorting/search, etc...

prime numbers c#

I'm new to C#. And I would like to program something like, displaying the prime numbers in a listbox if user will input any integer in the textbox. (that means, if they write 10, it will display the prime numbers from 0-10, or 20 from 0-20, etc).
What should I consider first, before I do the programming?
I know there are many examples in the internet, but first I would like to know what will I need?
Thanks for the tip;-)
===
Thanks guys. So you're suggesting that it's better to do it first in the Console application?
I did an example of "For Loop" using Console Application a very simple one, but then when I tried to do it in the Windows Form Application, I'm not sure how to implement it.
I'm afraid that if I keep doing examples in the Console, then I'll have difficulty to do it in Windows Form Apps.
What do you think?
======
Hello again,
I need some feedback with my code:
Console.WriteLine("Please enter your integer: ");
long yourInteger;
yourInteger = Int32.Parse(Console.ReadLine());
//displaying the first prime number and comparing it to the given integer
for (long i = 2; i <= yourInteger; i = i + 1)
{
//Controls i if its prime number or not
if ((i % 2 != 0) || (i == 2))
{
Console.Write("{0} ", i);
}
}
Well, first of all I'd think about how to find prime numbers, and write that in a console app that reads a line, does the math, and writes the results (purely because that is the simplest thing you can do, and covers the same parsing etc logic you'll need later).
When you are happy with the prime number generation, then look at how to do winforms - how to put a listbox, textbox and button on a form; how to handle the click event (of the button), and how to read from the textbox and write values into the listbox. Your prime code should be fairly OK to take "as is"...
If you don't already have an IDE, then note that C# Express is free and will cover all of the above.
You'll need to know:
How to read user input from a Windows application
How to generate prime numbers within a range
How to write output in the way that you want
I strongly suggest that you separate these tasks. Once you've got each of them working separately, you can put them together. (Marc suggests writing a console app for the prime number section - that's a good suggestion if you don't want to get into unit testing yet. If you've used unit testing in other languages, it's reasonably easy to get up and running with NUnit. A console app will certainly be quicker to get started with though.)
In theory, for a potentially long-running task (e.g. the user inputs 1000000 as the first number) you should usually use a background thread to keep the UI responsive. However, I would ignore that to start with. Be aware that while you're computing the primes, your application will appear to be "hung", but get it working at all first. Once you're confident with the simple version, you can look at BackgroundWorker and the like if you're feeling adventurous.
I discussed creating prime numbers using the Sieve of Eratosthenes on my blog here:
http://blogs.msdn.com/mpeck/archive/2009/03/03/Solving-Problems-in-CSharp-and-FSharp-Part-1.aspx
The code looks like this...
public IEnumerable<long> GetPrimes(int max)
{
var nonprimes = new bool[max + 1];
for (long i = 2; i <= max; i++)
{
if (nonprimes[i] == false)
{
for (var j = i * i; j <= max; j += i)
{
nonprimes[j] = true;
}
yield return i;
}
}
}
With this code you can write statements like this...
var primes = SieveOfEratosthenes.GetPrimes(2000);
... to get an IEnumerable of primes up to 2000.
All the code can be found on CodePlex at http://FSharpCSharp.codeplex.com.
The code is "as is" and so you should look at it to determine whether it suits your needs, whether you need to add error checking etc, so treat it as a sample.
Here's a great "naive" prime number algorithm, that would be perfect for your needs:
http://en.wikipedia.org/wiki/Sieve_of_Eratosthenes
Here is a response to the edit:
Thanks guys. So you're suggesting that it's better to do it first in the Console application? I did an example of "For Loop" using Console Application a very simple one, but then when I tried to do it in the Windows Form Application, I'm not sure how to implement it. I'm afraid that if I keep doing examples in the Console, then I'll have difficulty to do it in Windows Form Apps. What do you think?
If you want to present the prime numbers as a windows forms application then you need to design the user interface for it as well. That is a bit overkill for such a small problem to be solved. The easiest design you can do is to fill up a ListBox in your form (example).
If you're really keen on learning Windows Forms or WPF then there are several resources for this.
I was recently writing a routine to implement Sieve Of Eratosthenes and came across this thread. Just for the archives, here is my implementation:
static List<int> GetPrimeNumbers(int maxNumber)
{
// seed the master list with 2
var list = new List<int>() {2};
// start at 3 and build the complete list
var next = 3;
while (next <= maxNumber)
{
// since even numbers > 2 are never prime, ignore evens
if (next % 2 != 0)
list.Add(next);
next++;
}
// create copy of list to avoid reindexing
var primes = new List<int>(list);
// index starts at 1 since the 2's were never removed
for (int i = 1; i < list.Count; i++)
{
var multiplier = list[i];
// FindAll Lambda removes duplicate processing
list.FindAll(a => primes.Contains(a) && a > multiplier)
.ForEach(a => primes.Remove(a * multiplier));
}
return primes;
}
You could always seed it with "1, 2" if you needed 1 in your list of primes.
using System;
class demo
{
static void Main()
{
int number;
Console.WriteLine("Enter Number you Should be Checked Number is Prime or not Prime");
number = Int32.Parse(Console.ReadLine());
for(int i =2;i {
if(number % i == 0)
{
Console.WriteLine("Entered number is not Prime");
break;
}
}
if(number % i !=0)
{
Console.WriteLine("Entered Number is Prime");
}
Console.ReadLine();
}
}
Your approach is entirely wrong. Prime numbers are absolute and will never change. Your best bet is to pre-generate a long list of prime numbers. Then come up with an algorithm to quickly look up that number to determine if it is on the list. Then in your case (since you want to list all in the given range just do so). This solution will be much faster than any prime number finding algorithm implemented during run-time. If the integer entered is greater than your list then you can always implement the algorithm starting at that point.

Categories